ID: 938505782_938505788

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 938505782 938505788
Species Human (GRCh38) Human (GRCh38)
Location 2:131881169-131881191 2:131881217-131881239
Sequence CCTGATTCCCCATAGGACCAACT CTCCCCATCCAGTCAGACTGAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 0, 3: 5, 4: 72} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!