ID: 938536883_938536896

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 938536883 938536896
Species Human (GRCh38) Human (GRCh38)
Location 2:132255028-132255050 2:132255072-132255094
Sequence CCATACTCCCCTCGGAACCCAAA GAAGCTGCCCAGCGGGTCATGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!