ID: 938592721_938592729

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 938592721 938592729
Species Human (GRCh38) Human (GRCh38)
Location 2:132755095-132755117 2:132755140-132755162
Sequence CCTACCTGTGGAGCAGCTAGCAT CTGGCTGGAACCTAACTATTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!