ID: 938856711_938856716

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 938856711 938856716
Species Human (GRCh38) Human (GRCh38)
Location 2:135320163-135320185 2:135320210-135320232
Sequence CCTGAGTAGCTGGGACTACAGGC GTGAAAGATTCTGAAGATTAAGG
Strand - +
Off-target summary {0: 71612, 1: 190254, 2: 237127, 3: 179987, 4: 110598} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!