ID: 939025572_939025579

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 939025572 939025579
Species Human (GRCh38) Human (GRCh38)
Location 2:137009737-137009759 2:137009752-137009774
Sequence CCACTGGGTCCCTCCCACAACAT CACAACATGTGGGAATTATCCGG
Strand - +
Off-target summary {0: 635, 1: 2188, 2: 3570, 3: 4909, 4: 5372} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!