ID: 939069230_939069241

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 939069230 939069241
Species Human (GRCh38) Human (GRCh38)
Location 2:137518912-137518934 2:137518949-137518971
Sequence CCTCTTCCATCATGGAAAGGGCA CTGGAAAAGGGGAAAGGGGCTGG
Strand - +
Off-target summary {0: 131, 1: 184, 2: 150, 3: 123, 4: 297} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!