ID: 939069232_939069241

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 939069232 939069241
Species Human (GRCh38) Human (GRCh38)
Location 2:137518918-137518940 2:137518949-137518971
Sequence CCATCATGGAAAGGGCAGAGGTT CTGGAAAAGGGGAAAGGGGCTGG
Strand - +
Off-target summary {0: 121, 1: 172, 2: 117, 3: 132, 4: 278} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!