ID: 939467551_939467554

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 939467551 939467554
Species Human (GRCh38) Human (GRCh38)
Location 2:142578404-142578426 2:142578419-142578441
Sequence CCATCCTCCTTTGGCTTCTTCAT TTCTTCATTCTTTTCCCTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 75, 4: 747} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!