ID: 939629280_939629288

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 939629280 939629288
Species Human (GRCh38) Human (GRCh38)
Location 2:144514948-144514970 2:144514974-144514996
Sequence CCACCTGCGAAGCGCCCAACGGG CCCTCTCTGCCAGGTCTCCTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!