ID: 939788682_939788686

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 939788682 939788686
Species Human (GRCh38) Human (GRCh38)
Location 2:146546097-146546119 2:146546114-146546136
Sequence CCAAACCCCAGTAACAGGCCAAG GCCAAGAGTTGTCTCTCAAAAGG
Strand - +
Off-target summary No data {0: 17, 1: 192, 2: 177, 3: 161, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!