ID: 939870526_939870529

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 939870526 939870529
Species Human (GRCh38) Human (GRCh38)
Location 2:147521324-147521346 2:147521357-147521379
Sequence CCACTCAAAATAATTCTCACATT CACATGAAAGTGCCACCCCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 13, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!