ID: 939992474_939992486

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 939992474 939992486
Species Human (GRCh38) Human (GRCh38)
Location 2:148888382-148888404 2:148888407-148888429
Sequence CCTCTGCCCCGCAGGACAAAAGC CCATTAGGGGGCCCTGTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 274} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!