ID: 940144163_940144170

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 940144163 940144170
Species Human (GRCh38) Human (GRCh38)
Location 2:150527845-150527867 2:150527860-150527882
Sequence CCTGTAATCCCAGAACTTTGGAA CTTTGGAAGGCCAAGGTGGGAGG
Strand - +
Off-target summary {0: 266, 1: 16102, 2: 316502, 3: 263404, 4: 142236} {0: 885, 1: 24065, 2: 76396, 3: 155349, 4: 159486}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!