ID: 940337518_940337529

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 940337518 940337529
Species Human (GRCh38) Human (GRCh38)
Location 2:152544773-152544795 2:152544811-152544833
Sequence CCCACTTCCATACCCCACATGGA GGAAGAGGTGGGCTTCCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 149} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!