ID: 940352057_940352062

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 940352057 940352062
Species Human (GRCh38) Human (GRCh38)
Location 2:152701837-152701859 2:152701889-152701911
Sequence CCAGACTCTCGGCAACAAGAAAA TCTCACATGCTGCAGCAACCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 22, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!