ID: 940429132_940429137

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 940429132 940429137
Species Human (GRCh38) Human (GRCh38)
Location 2:153567430-153567452 2:153567469-153567491
Sequence CCAGGTAAGGACACAAAGGCCTG AGGTGAATACCCTGCTTTGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!