ID: 940502327_940502340

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 940502327 940502340
Species Human (GRCh38) Human (GRCh38)
Location 2:154508464-154508486 2:154508507-154508529
Sequence CCGCCTCGGCCTCCCAAAGTACT CCGTGCCCGGCCGGTACCTTGGG
Strand - +
Off-target summary {0: 1945, 1: 95817, 2: 190949, 3: 137757, 4: 71500} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!