ID: 940502331_940502340

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 940502331 940502340
Species Human (GRCh38) Human (GRCh38)
Location 2:154508473-154508495 2:154508507-154508529
Sequence CCTCCCAAAGTACTGGGATTACA CCGTGCCCGGCCGGTACCTTGGG
Strand - +
Off-target summary {0: 8216, 1: 308215, 2: 267713, 3: 148631, 4: 131048} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!