ID: 940502334_940502340

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 940502334 940502340
Species Human (GRCh38) Human (GRCh38)
Location 2:154508477-154508499 2:154508507-154508529
Sequence CCAAAGTACTGGGATTACAGGCA CCGTGCCCGGCCGGTACCTTGGG
Strand - +
Off-target summary {0: 2978, 1: 100625, 2: 239072, 3: 244644, 4: 213708} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!