ID: 940621641_940621644

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 940621641 940621644
Species Human (GRCh38) Human (GRCh38)
Location 2:156120962-156120984 2:156120989-156121011
Sequence CCTAGAGACTTGTTTAATGGCTT CAAAATGCTAATAGTGATATGGG
Strand - +
Off-target summary {0: 18, 1: 1557, 2: 1958, 3: 1378, 4: 960} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!