ID: 940656162_940656180

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 940656162 940656180
Species Human (GRCh38) Human (GRCh38)
Location 2:156489939-156489961 2:156489991-156490013
Sequence CCCTCCCACTACCCCCTCTCCCT TAGGGCCTATGGCCATTCCAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!