ID: 940844903_940844909

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 940844903 940844909
Species Human (GRCh38) Human (GRCh38)
Location 2:158629854-158629876 2:158629885-158629907
Sequence CCCAGCCTCAGCTGGGATTACAG CACCATGCCCAGCTAATTTTTGG
Strand - +
Off-target summary No data {0: 195, 1: 480, 2: 982, 3: 1326, 4: 1529}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!