ID: 940844903_940844913

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 940844903 940844913
Species Human (GRCh38) Human (GRCh38)
Location 2:158629854-158629876 2:158629902-158629924
Sequence CCCAGCCTCAGCTGGGATTACAG TTTTGGATTTTTAGTAGAGTCGG
Strand - +
Off-target summary No data {0: 11, 1: 2640, 2: 209330, 3: 140543, 4: 70693}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!