ID: 940847914_940847924

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 940847914 940847924
Species Human (GRCh38) Human (GRCh38)
Location 2:158661311-158661333 2:158661330-158661352
Sequence CCTCCTGTCTCCACCCCTTTAGG TAGGAACCTCAGCTCCGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 258} {0: 1, 1: 0, 2: 0, 3: 2, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!