ID: 940856219_940856229

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 940856219 940856229
Species Human (GRCh38) Human (GRCh38)
Location 2:158730575-158730597 2:158730619-158730641
Sequence CCACATGAATGCCCACTACTGAC CAGGGGTTTGGGGTTGCCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 88} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!