ID: 940962159_940962173

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 940962159 940962173
Species Human (GRCh38) Human (GRCh38)
Location 2:159797977-159797999 2:159798015-159798037
Sequence CCCACGGGGGACGGGCGTGCAGG CGGCCGGGTGTTGCGTCTGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 91} {0: 1, 1: 0, 2: 0, 3: 3, 4: 45}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!