ID: 940992724_940992730

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 940992724 940992730
Species Human (GRCh38) Human (GRCh38)
Location 2:160114477-160114499 2:160114499-160114521
Sequence CCTGGGAAGGTCCAGGGAGGGTG GTGAAAAATACAAAGCAGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 452} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!