ID: 941319352_941319355

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 941319352 941319355
Species Human (GRCh38) Human (GRCh38)
Location 2:164034963-164034985 2:164034977-164034999
Sequence CCACACCCAGCTGGTTTTGTATT TTTTGTATTTTTAGTAGAGATGG
Strand - +
Off-target summary No data {0: 194929, 1: 143151, 2: 66814, 3: 37831, 4: 46551}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!