ID: 941319352_941319356

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 941319352 941319356
Species Human (GRCh38) Human (GRCh38)
Location 2:164034963-164034985 2:164034978-164035000
Sequence CCACACCCAGCTGGTTTTGTATT TTTGTATTTTTAGTAGAGATGGG
Strand - +
Off-target summary No data {0: 86734, 1: 238723, 2: 156972, 3: 78020, 4: 57628}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!