ID: 941319352_941319358

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 941319352 941319358
Species Human (GRCh38) Human (GRCh38)
Location 2:164034963-164034985 2:164034998-164035020
Sequence CCACACCCAGCTGGTTTTGTATT GGGGTTTCTCCACGTTTGTCAGG
Strand - +
Off-target summary No data {0: 12, 1: 712, 2: 14641, 3: 38593, 4: 139078}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!