ID: 941360607_941360610

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 941360607 941360610
Species Human (GRCh38) Human (GRCh38)
Location 2:164546828-164546850 2:164546856-164546878
Sequence CCAAAGGAGACACCAAATCAGAG GTTCAGCAGCACCACACGATAGG
Strand - +
Off-target summary {0: 11, 1: 26, 2: 68, 3: 88, 4: 243} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!