ID: 941360609_941360610

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 941360609 941360610
Species Human (GRCh38) Human (GRCh38)
Location 2:164546840-164546862 2:164546856-164546878
Sequence CCAAATCAGAGTGGCTGTTCAGC GTTCAGCAGCACCACACGATAGG
Strand - +
Off-target summary {0: 21, 1: 71, 2: 56, 3: 63, 4: 141} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!