ID: 941425435_941425440

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 941425435 941425440
Species Human (GRCh38) Human (GRCh38)
Location 2:165338929-165338951 2:165338962-165338984
Sequence CCCTACATCTAGCCGGGCGTGGA TGTAATCCCAGCACTTTGTGAGG
Strand - +
Off-target summary No data {0: 2119, 1: 302734, 2: 268149, 3: 150508, 4: 132167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!