ID: 941425435_941425442

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 941425435 941425442
Species Human (GRCh38) Human (GRCh38)
Location 2:165338929-165338951 2:165338968-165338990
Sequence CCCTACATCTAGCCGGGCGTGGA CCCAGCACTTTGTGAGGCTGAGG
Strand - +
Off-target summary No data {0: 563, 1: 89236, 2: 212635, 3: 238365, 4: 264805}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!