ID: 941470833_941470836

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 941470833 941470836
Species Human (GRCh38) Human (GRCh38)
Location 2:165884970-165884992 2:165884995-165885017
Sequence CCTCGCCTCAACTGAAAATACAA GAAAAACTAGCTGAGTGTGGTGG
Strand - +
Off-target summary No data {0: 3, 1: 119, 2: 3670, 3: 38857, 4: 99208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!