ID: 941470833_941470840

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 941470833 941470840
Species Human (GRCh38) Human (GRCh38)
Location 2:165884970-165884992 2:165885023-165885045
Sequence CCTCGCCTCAACTGAAAATACAA CCCTGTAGTCCCAGCTACTCAGG
Strand - +
Off-target summary No data {0: 1264, 1: 104922, 2: 239865, 3: 244476, 4: 148981}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!