ID: 941470893_941470905

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 941470893 941470905
Species Human (GRCh38) Human (GRCh38)
Location 2:165885537-165885559 2:165885556-165885578
Sequence CCCTCTCCCCACCTCAGCCCACC CACCTCAGGTGGGCCAGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 32, 3: 513, 4: 3765} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!