ID: 941836000_941836009

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 941836000 941836009
Species Human (GRCh38) Human (GRCh38)
Location 2:170021550-170021572 2:170021579-170021601
Sequence CCCACCTCCTTATACTAACCTTG GGACTTCAACATATGAATTTTGG
Strand - +
Off-target summary No data {0: 148, 1: 1017, 2: 2212, 3: 3420, 4: 4021}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!