ID: 941836000_941836010

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 941836000 941836010
Species Human (GRCh38) Human (GRCh38)
Location 2:170021550-170021572 2:170021582-170021604
Sequence CCCACCTCCTTATACTAACCTTG CTTCAACATATGAATTTTGGTGG
Strand - +
Off-target summary No data {0: 154, 1: 911, 2: 2311, 3: 3605, 4: 4287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!