ID: 942243917_942243923

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 942243917 942243923
Species Human (GRCh38) Human (GRCh38)
Location 2:173990055-173990077 2:173990096-173990118
Sequence CCCATCACACAGCACACAGGAGA CAAGCTACTCACCTTTAGGTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 90, 4: 579} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!