ID: 942317310_942317320

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 942317310 942317320
Species Human (GRCh38) Human (GRCh38)
Location 2:174707956-174707978 2:174707999-174708021
Sequence CCTTTCACCTTCTGGATATTAGA TGTACACCCCCTGCAATATTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!