ID: 942346254_942346264

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 942346254 942346264
Species Human (GRCh38) Human (GRCh38)
Location 2:175005440-175005462 2:175005478-175005500
Sequence CCCATGGCAACGGGCGCGCGCGG CCCTCATTCCCGCGGCTGCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 27} {0: 1, 1: 0, 2: 0, 3: 9, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!