ID: 942632416_942632419

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 942632416 942632419
Species Human (GRCh38) Human (GRCh38)
Location 2:177965248-177965270 2:177965295-177965317
Sequence CCTTAAAGATTCTGGATGTTAGG AATATTTTCTCCCATCCTGTAGG
Strand - +
Off-target summary No data {0: 66, 1: 2576, 2: 14094, 3: 18986, 4: 8860}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!