ID: 943173209_943173214

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 943173209 943173214
Species Human (GRCh38) Human (GRCh38)
Location 2:184431648-184431670 2:184431699-184431721
Sequence CCCTTAAAATGAGGTGGTATGTG GAATCAGAATGGCTGAATAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 176} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!