ID: 943544698_943544701

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 943544698 943544701
Species Human (GRCh38) Human (GRCh38)
Location 2:189260309-189260331 2:189260325-189260347
Sequence CCTAGGAGTACAGTGCCTGCAAA CTGCAAATGCCAAGGCTAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 190} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!