ID: 943605522_943605524

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 943605522 943605524
Species Human (GRCh38) Human (GRCh38)
Location 2:189972844-189972866 2:189972858-189972880
Sequence CCTTGCTAAAGTTGCTTATCAGC CTTATCAGCTTAAGGAGATTTGG
Strand - +
Off-target summary No data {0: 712, 1: 622, 2: 483, 3: 370, 4: 392}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!