ID: 943605522_943605525

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 943605522 943605525
Species Human (GRCh38) Human (GRCh38)
Location 2:189972844-189972866 2:189972859-189972881
Sequence CCTTGCTAAAGTTGCTTATCAGC TTATCAGCTTAAGGAGATTTGGG
Strand - +
Off-target summary No data {0: 9766, 1: 5142, 2: 2748, 3: 1620, 4: 1461}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!