ID: 943605522_943605527

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 943605522 943605527
Species Human (GRCh38) Human (GRCh38)
Location 2:189972844-189972866 2:189972872-189972894
Sequence CCTTGCTAAAGTTGCTTATCAGC GAGATTTGGGGCTGAGATGATGG
Strand - +
Off-target summary No data {0: 209, 1: 2208, 2: 4843, 3: 7138, 4: 3273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!