ID: 943804461_943804464

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 943804461 943804464
Species Human (GRCh38) Human (GRCh38)
Location 2:192105701-192105723 2:192105723-192105745
Sequence CCATAATAAAACTAATTCCAAAA ACATATATGCAGAAAATGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 43, 4: 519}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!