ID: 943811701_943811705

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 943811701 943811705
Species Human (GRCh38) Human (GRCh38)
Location 2:192195544-192195566 2:192195572-192195594
Sequence CCGACCTGGAAGCAACAGCAGCA CACAAGAGCGTGCAACCCCAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 28, 4: 269} {0: 1, 1: 0, 2: 1, 3: 6, 4: 62}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!